MIR369 is a family of microRNAs that has been extensively studied in various biological processes. It is located on chromosome 8 and has been shown to enhance the expression of PKM2 through the stabilization of HNRNPA2B1 in cell reprogramming [PMC7780020]. MIR369 has also been found to inhibit the proliferation and metastasis of hepatocellular carcinoma cells by directly targeting ZEB1 [PMC8040887]. It is regulated by FUS3, a transcription factor that controls the expression of several miRNA genes, including MIR369 [PMC4162360]. In various studies, MIR369 has been identified as a hub gene in different biological contexts, such as SJS/TEN [PMC9027774]. It has also been implicated in cell reprogramming processes, where it can enhance the efficiency of reprogramming by replacing traditional nuclear factors [PMC5951134]. Additionally, MIR369 has been found to target genes involved in stomatal movement and growth-regulating factors (GRF) silence [PMC8233840] [PMC8417703]. The expression level of MIR369 can vary depending on the cell type and differentiation state. In pluripotent cells, it is highly expressed but decreases upon differentiation [PMC4503752]. The epigenetic regulation of MIR369 coding region also plays a role in its expression pattern during differentiation [PMC4503752]. Overall, these studies highlight the diverse roles and regulatory mechanisms associated with MIR369.
u a UA Cuuua uga gggAGAUCGACCGUGU UAUUCG u ||| |||||||||||||||| |||||| acu uUUUCUAGUUGGUACA AUAAgc u g c UA uucag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001621 |
Description | Homo sapiens hsa-miR-369-5p mature miRNA |
Sequence | 9 - AGAUCGACCGUGUUAUAUUCGC - 30 |
Evidence |
experimental
cloned [2-4] |
Database links | |
Predicted targets |
Accession | MIMAT0000721 |
Description | Homo sapiens hsa-miR-369-3p mature miRNA |
Sequence | 44 - AAUAAUACAUGGUUGAUCUUU - 64 |
Evidence |
experimental
cloned [1-4] |
Database links | |
Predicted targets |
|