MIR501 is a microRNA that has been found to be elevated in plasma in cases of community-acquired pneumonia (CAP), along with other miRNAs such as MIR100, MIR99A, MIR483, MIR141, MIR378C, and MIR193B [PMC8358855]. In wheat, sequencing efforts have identified 58 wheat miRNAs, including 23 novel ones such as MIR501 [PMC5360763]. In a study on schizophrenia, two single-nucleotide polymorphisms upstream of MIR501 and two ultrarare protein-altering variants in its host gene CLCN5 were found to be associated with the disorder [PMC9390987]. The function of miR-501-3p in schizophrenia was investigated using a mouse model with the knockout of the MIR501 gene [PMC9390987]. The human counterpart of mouse MIR501 is located on chromosome Xp11.23 within the CLCN5 gene [PMC9390987]. MiR-501-3p has been shown to be highly expressed in multiple tissues and specific neuronal types [PMC9390987]. The role of miR-501-3p in the pathophysiology of schizophrenia is still being investigated [PMC9390987]. MiR-501 is part of a cluster that includes other microRNAs such as miR532 and miR362 [PMC4241533]. MiR500A is also part of this cluster and has been associated with different cancer types [PMC8253104]. In addition to its role in schizophrenia, miR-501 has also been implicated in synaptic plasticity regulation and periodontitis pathogenesis [PMC4783348] [PMC9314012].
u -u U U U AGAg uuu gcuc uccucuc AAUCCUU G CCC GGGUG ugc c |||| ||||||| ||||||| | ||| ||||| ||| u cgag gggagag UUAGGAA C GGG CCCAC Acg g u UC - - - -GUA uaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002872 |
Description | Homo sapiens hsa-miR-501-5p mature miRNA |
Sequence | 14 - AAUCCUUUGUCCCUGGGUGAGA - 35 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004774 |
Description | Homo sapiens hsa-miR-501-3p mature miRNA |
Sequence | 51 - AAUGCACCCGGGCAAGGAUUCU - 72 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|