MIR455 is a microRNA that is implicated in various diseases and conditions. It is specifically linked with hepatocellular carcinoma (HCC), gastric cancer (GC), and colorectal cancer (CRC) [PMC8369952]. In addition, MIR455 is associated with endometrial cancers [PMC8369952]. It has been found that certain microRNAs, including MIR455, regulate brown adipocyte differentiation [PMC7123371]. In multiple myeloma patients, high expression of MIR455 is considered a favorable prognostic factor [PMC6183594]. Furthermore, irregular expression of MIR455 has been observed in patients with preeclampsia, suggesting its potential role in the pathogenesis of the condition [PMC4540200]. Interestingly, MIR455 has also been detected in the exosomal population after exercise in type 2 diabetic mice, indicating that its content varies depending on the cells of origin at the time of secretion [PMC4568920]. MIR455 and Mir511 are largely expressed in the alimentary system and are involved in response to stimulus processes [PMC8369952]. In terms of cardiovascular health, MIR455 has been found to be cardioprotective in type 1 diabetes mellitus (T1DM) while Mir22 plays a similar role in type 2 diabetes mellitus (T2DM) [PMC7593653]. The formation of MIR455 is induced by cold temperature exposure and BMP7. This induction is necessary for the development of both brown adipose tissue (BAT) and recruitable beige adipose tissue (BeAT) [PMC7123371]. To verify predicted targets for MIR455 and to test its functionality within miRNA-induced silencing complex (miRISC), a dual luciferase-based miRNA-activity reporter assay was adopted. This assay involved renilla luciferase (RL) and firefly luciferase (FL) reporter genes [PMC4540200]. The observed elevation in mature MIR455 in BeWo cells upon FSK treatment can be attributed to increased expression of the COL27A1 gene [PMC4540200].
----ucccu -g ----- U A C gaa ggc ugagg gUAUGUGCCU UGGACU CAU Gug g ||| ||||| |||||||||| |||||| ||| ||| ccg acucc CAUAUACGGG ACCUGA Gua cac c cuacuguau ga guuCA U C c gac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003150 |
Description | Homo sapiens hsa-miR-455-5p mature miRNA |
Sequence | 16 - UAUGUGCCUUUGGACUACAUCG - 37 |
Evidence |
experimental
Northern [1], cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004784 |
Description | Homo sapiens hsa-miR-455-3p mature miRNA |
Sequence | 54 - GCAGUCCAUGGGCAUAUACAC - 74 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
|