hsa-mir-877 is a microRNA that has been reported as an oncogene in gastric cancer [PMC7794682]. In nonresponder samples of both lung squamous cell carcinoma (LUSC) and head and neck squamous cell carcinoma (HNSC), hsa-mir-877 was found to be upregulated, along with hsa-miR-130a and hsa-miR-15a [PMC7794682]. Furthermore, in a study on endometrial cancer (EC), hsa-mir-877 was identified as one of the candidate reference genes that showed uniform expression [PMC3531299].
-GUA AU C C g caaagac c GAGGAG GG G AGGGgacacg g uuggggguuc |||||| || | |||||||||| | |||||||||| u CUCCUC CC C UCUCCUgugu c gacucccagg GACC -- U U g ------a g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004949 |
Description | Homo sapiens hsa-miR-877-5p mature miRNA |
Sequence | 1 - GUAGAGGAGAUGGCGCAGGG - 20 |
Evidence |
experimental
cloned [1-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004950 |
Description | Homo sapiens hsa-miR-877-3p mature miRNA |
Sequence | 66 - UCCUCUUCUCCCUCCUCCCAG - 86 |
Evidence |
experimental
cloned [1-3] |
Database links | |
Predicted targets |
|