MIR548P is a microRNA that has been found to significantly decrease lipoprotein production and lipid synthesis in hepatocytes. It achieves this by lowering the activity of 3-hydroxy 3-methylglutarylCoA reductase and long-chain acylCoA synthetase ACSL471, which are involved in cholesterol and fatty acid synthesis. However, MIR548P does not affect fatty acid oxidation [PMC7123062]. MIR548P interacts with the 3′-untranslated region of the APOB mRNA, leading to its post-transcriptional degradation and reducing ApoB synthesis and secretion from hepatocytes [PMC7123062]. It has been found that MIR548P reduces ApoB secretion and lipid synthesis through its effects on HMGCoAR and long-chain fatty acylCoA synthase ACSL4 [PMC7123062]. In the context of esophageal squamous cell carcinoma (ESCC), high expression of MIR548P, along with TRAV39, has been associated with a poor prognosis due to the promotion of antitumor immunity [PMC9509226]. Additionally, MIR548P expression was found to be negatively associated with activated mast cells but positively associated with activated T cell CD4 memory cells [PMC9509226]. The expression levels of MIR548P were also found to be correlated with the immune microenvironment in ESCC patients [PMC9509226]. Furthermore, low expression levels of MIR548P were associated with a lower 5-year overall survival rate in ESCC patients [PMC9509226'>PMC9509226]. However, there was no evidence supporting a positive link between the expression of MIR548P and clinicopathological characteristics in ESCC patients [PMC9509226]. Overall, TRAV39 and MIR548P expressions may serve as predictors for clinical outcomes in ESCC patients by reflecting the status of the tumor microenvironment [PMC9509226].
-- g a u c ac auua guuggu uaaaa uaauugcaguuuuugu auu u |||| |||||| ||||| |||||||||||||||| ||| uaau uaacca guUUU AUUGACGUCAAAAACG Uaa u ca g c C A cu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005934 |
Description | Homo sapiens hsa-miR-548p mature miRNA |
Sequence | 47 - UAGCAAAAACUGCAGUUACUUU - 68 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|