MIR3180-3 is a type of microRNA that is disrupted in an individual from Tibet, along with other microRNAs (mir517b, mir517a, mir517c) and their target genes (CD44, FAM115A) [PMC3938728]. In Alzheimer's disease (AD), differentially expressed long non-coding RNAs (lncRNAs) target protein-coding genes (PCGs) involved in AD- and aging-related biological functions [PMC7047416]. Specifically, MIR3180-3 and MIR3180-2 target PCGs involved in the neuroprotective role of THOP1 in AD and blood vessel remodeling [PMC7047416]. Additionally, MIR3180-2 and MIR3180-3 share co-expressed PCGs that are known to be AD-related [PMC7047416]. These findings suggest that MIR3180-3 may play a role in the pathogenesis of AD. In breast cancer, MIR3180-3 is identified as one of the miRNAs present in multiple breast cancer cell lines but absent in normal-like cell lines [PMC8261273]. In luminal-A breast cancer subtype, MIR3180-3 targets multiple genes including A4GALT, C10orf55, C2orf74, ZC4H2, ZNF512, ZNF655, ZNF71 HCG2042738 and HRCT1 [PMC8261273]. Furthermore, MIR3180-3 is observed in both luminal-A and triple-negative breast cancer subtypes [PMC8261273].
cagu ac a A C CGca g c gcg gggcgg gCUUCC GA GCUCCGCCCCACGU u cg ||| |||||| |||||| || |||||||||||||| | || c cgu cccgcc CGGAGG CU CGAGGCGGGGUgcg g gc --gu -- C C U -aaa g c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0015057 |
Description | Homo sapiens hsa-miR-3180-5p mature miRNA |
Sequence | 18 - CUUCCAGACGCUCCGCCCCACGUCG - 42 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
Accession | MIMAT0015058 |
Description | Homo sapiens hsa-miR-3180-3p mature miRNA |
Sequence | 62 - UGGGGCGGAGCUUCCGGAGGCC - 83 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|