Deep sequencing reads for stem-loop sequence MI0000419

Stem-loop ID dme-mir-308
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
  dme-miR-308-5p                         dme-miR-308-3p           Count     RPM (mean number of reads per million)
.UCGCAGUAUAUUUUUGUGUUUU........................................  14        1.23
.UCGCAGUAUAUUUUUGUGUUUUG.......................................  3         0.0932
.UCGCAGUAUAUUUUUGUGUUU.........................................  1         0.0465
..CGCAGUAUAUUUUUGUGUUUUG.......................................  22243     3.33e+03
..CGCAGUAUAUUUUUGUGUUUU........................................  865       84.5
..CGCAGUAUAUUUUUGUGUUU.........................................  367       42.7
..CGCAGUAUAUUUUUGUGUU..........................................  138       15.8
..CGCAGUAUAUUUUUGUGU...........................................  116       1.89
..CGCAGUAUAUUUUUGUG............................................  112       3.03
..CGCAGUAUAUUUUUGUGUUUUGU......................................  83        4.01
..CGCAGUAUAUUUUUGUGUUUUGUU.....................................  3         0.0131
..CGCAGUAUAUUUUUGUGUUUUGUUU....................................  3         0.243
..CGCAGUAUAUUUUUGUGUUUUGUUUCG..................................  2         0.17
..CGCAGUAUAUUUUUGUGUUUUGUUUC...................................  1         0.187
...GCAGUAUAUUUUUGUGUUUUG.......................................  143       21.7
...GCAGUAUAUUUUUGUGUUU.........................................  8         1.4
...GCAGUAUAUUUUUGUGU...........................................  5         0.0818
...GCAGUAUAUUUUUGUGUUUU........................................  3         0.477
...GCAGUAUAUUUUUGUGUU..........................................  2         0.0653
....CAGUAUAUUUUUGUGUUUUG.......................................  26        4.4
....CAGUAUAUUUUUGUGUUUU........................................  3         0.659
.....AGUAUAUUUUUGUGUUUUG.......................................  25        5.24
.....AGUAUAUUUUUGUGUUUU........................................  1         0.22
......GUAUAUUUUUGUGUUUUG.......................................  173       36.5
......GUAUAUUUUUGUGUUUU........................................  4         0.878
.......UAUAUUUUUGUGUUUUG.......................................  24        4.98
.........UAUUUUUGUGUUUUGUUUCGU.................................  1         0.0978
........................UUUCGUUUUGCAAUCCA......................  11        0.108
........................UUUCGUUUUGCAAUCCAAA....................  9         0.474
........................UUUCGUUUUGCAAUCCAA.....................  4         0.28
........................................AAAUCACAGGAUUAUACUGUGAG  2360      30.5
........................................AAAUCACAGGAUUAUACUGUGA.  67        2.86
.........................................AAUCACAGGAUUAUACUGUGAG  669161    8.75e+03
.........................................AAUCACAGGAUUAUACUGUGA.  190035    2.62e+03
.........................................AAUCACAGGAUUAUACUGUG..  603       9.1
.........................................AAUCACAGGAUUAUACUGU...  390       14.1
.........................................AAUCACAGGAUUAUACU.....  97        2.22
.........................................AAUCACAGGAUUAUACUG....  87        5.56
..........................................AUCACAGGAUUAUACUGUGAG  1590      31.2
..........................................AUCACAGGAUUAUACUGUGA.  170       8.72
..........................................AUCACAGGAUUAUACUGUG..  8         1.75
..........................................AUCACAGGAUUAUACUG....  2         0.0159
..........................................AUCACAGGAUUAUACUGU...  1         0.0723
...........................................UCACAGGAUUAUACUGUGAG  106       3.01
...........................................UCACAGGAUUAUACUGUGA.  34        1.08
...........................................UCACAGGAUUAUACUGUG..  2         0.0486
............................................CACAGGAUUAUACUGUGAG  76        12.7
............................................CACAGGAUUAUACUGUGA.  33        1.07
.............................................ACAGGAUUAUACUGUGAG  9187      117
.............................................ACAGGAUUAUACUGUGA.  1449      16.3
..............................................CAGGAUUAUACUGUGAG  43        2.7
CUCGCAGUAUAUUUUUGUGUUUUGUUUCGUUUUGCAAUCCAAAUCACAGGAUUAUACUGUGAG
(((((((((((.(((((((.((((..(.(.....).)..)))).))))))).))))))))))) (-24.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000010 565head GEO : GSM240749 [ Chung WJ et al.]
ER0000000011 706S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 1774S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 1772Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000014 145imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000015 495head GEO : GSM286601 [ Chung WJ et al.]
ER0000000016 164whole body GEO : GSM286602 [ Chung WJ et al.]
ER0000000017 197whole body GEO : GSM286603 [ Chung WJ et al.]
ER0000000018 2293embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000019 3837embryo GEO : GSM286605 [ Chung WJ et al.]
ER0000000020 580embryo GEO : GSM286606 [ Chung WJ et al.]
ER0000000021 1037embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000022 1600embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000023 1553embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000079 368whole body GEO : GSM322208 3rd instar larvae
ER0000000080 695whole body GEO : GSM322219 2-4 day old pupae
ER0000000081 74whole body GEO : GSM322245 3rd instar larvae
ER0000000082 76whole body GEO : GSM322338 2-4 day old pupae
ER0000000083 1195head GEO : GSM322533 adult female head
ER0000000084 4631head GEO : GSM322543 adult male head
ER0000000085 81whole body GEO : GSM360256 1st instar larvae
ER0000000086 136whole body GEO : GSM360257 1st instar larvae
ER0000000087 367whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 2093whole body GEO : GSM360262 0-2 day old pupae
ER0000000089 66embryo GEO : GSM364902 12-24hr embryo
ER0000000090 323whole body GEO : GSM280082 from 2-4 day old flies
ER0000000091 428whole body GEO : GSM280083 from 2-4 day old flies
ER0000000092 217whole body GEO : GSM280084 from 2-4 day old flies
ER0000000093 30whole body GEO : GSM280085 from 2-4 day old flies
ER0000000094 6799whole body GEO : GSM280086 from 2-4 day old flies
ER0000000095 7220S2 cell GEO : GSM280087
ER0000000096 579S2 cell GEO : GSM280088
ER0000000099 442imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000100 774whole body GEO : GSM399106 female body
ER0000000101 693whole body GEO : GSM399107 male body
ER0000000102 4587S2 cell GEO : GSM371638
ER0000000115 157head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]
ER0000000116 48whole body GEO : GSM180329 adult bodies (female bodies, male bodies) [ Ruby JG et al.]
ER0000000117 107embryo GEO : GSM180330 very early embryo (0-1) [ Ruby JG et al.]
ER0000000118 146embryo GEO : GSM180331 early embryo (2-6) [ Ruby JG et al.]
ER0000000119 72embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]
ER0000000120 29embryo GEO : GSM180333 late embryo (12-24) [ Ruby JG et al.]
ER0000000121 22whole body GEO : GSM180334 larvae: 1st instar and 3rd instars [ Ruby JG et al.]
ER0000000122 51imaginal disc GEO : GSM180335 [ Ruby JG et al.]
ER0000000123 31whole body GEO : GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day [ Ruby JG et al.]
ER0000000124 197S2 cell GEO : GSM180337 tissue culture cells (S2 only) [ Ruby JG et al.]
ER0000000127 125741ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 264517ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 357658ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells
ER0000000130 144647ovary GEO : GSM385822 Ovary Somatic Sheet (OSS) cells
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:18501606 "Endogenous RNA interference provides a somatic defense against Drosophila transposons" Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).