Deep sequencing reads for stem-loop sequence MI0000816

Stem-loop ID hsa-mir-335
Reads 
               hsa-miR-335-5p                     hsa-miR-335-3p                                Count     RPM (mean number of reads per million)
...........GGGGUCAAGAGCAAUAACGAAAAAU..........................................................  16        23.9
...........GGGGUCAAGAGCAAUAACGAAAAAUG.........................................................  8         15.5
...........GGGGUCAAGAGCAAUAACGAAAA............................................................  1         1.27
............GGGUCAAGAGCAAUAACGAAAAAUGU........................................................  244       467
............GGGUCAAGAGCAAUAACGAAAAA...........................................................  177       454
............GGGUCAAGAGCAAUAACGAAAAAUG.........................................................  162       602
............GGGUCAAGAGCAAUAACGAAAAAU..........................................................  138       410
............GGGUCAAGAGCAAUAACGAAA.............................................................  111       234
............GGGUCAAGAGCAAUAACGAAAA............................................................  45        136
............GGGUCAAGAGCAAUAACGAA..............................................................  33        87.1
............GGGUCAAGAGCAAUAACGA...............................................................  20        45.7
............GGGUCAAGAGCAAUAACG................................................................  19        47.4
............GGGUCAAGAGCAAUAAC.................................................................  11        39.3
............GGGUCAAGAGCAAUAACGAAAAAUGUU.......................................................  6         9.22
...............UCAAGAGCAAUAACGAAAAAUG.........................................................  297       31.6
...............UCAAGAGCAAUAACGAAAAAUGU........................................................  174       14.9
...............UCAAGAGCAAUAACGAAAAAU..........................................................  30        3.37
...............UCAAGAGCAAUAACGAAAAA...........................................................  7         0.365
...............UCAAGAGCAAUAACGAAAA............................................................  5         17
...............UCAAGAGCAAUAACGAAA.............................................................  4         17
................CAAGAGCAAUAACGAAAAAUGU........................................................  1         0.239
..................................................GUUUUUCAUUAUUGCUCCUGAC......................  1         0.239
...................................................UUUUUCAUUAUUGCUCCUGACC.....................  5         0.605
....................................................UUUUCAUUAUUGCUCCUGACC.....................  1         0.239
....................................................UUUUCAUUAUUGCUCCUGAC......................  1         0.239
UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA
.((..((((.((((((((.(((((((((.((((((((.((......)).)))))))).))))))))).)))))))).))))...))........ (-41.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 10embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 194embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000106 50melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000108 18melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 65melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 143melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 62melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000138 60squamous cell GEO : GSM532874 [ Witten D et al.]
ER0000000140 12squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000143 2 GEO : GSM532879 normal cervix [ Witten D et al.]
ER0000000147 3 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000149 2 GEO : GSM532885 normal cervix [ Witten D et al.]
ER0000000150 114squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000154 2squamous cell GEO : GSM532890 [ Witten D et al.]
ER0000000155 39 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000156 617squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000160 2132squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000161 34 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000164 734squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 15 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000167 1 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000168 139adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000171 25 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000173 15 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000174 237squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000175 2 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000178 495squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000179 13 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000180 329squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000181 5 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000185 15 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000186 532squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000187 1 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000188 448squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000193 3 GEO : GSM532929 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).