Deep sequencing reads for stem-loop sequence MI0003632

Stem-loop ID hsa-mir-618
Reads 
                  hsa-miR-618                                                                      Count     RPM (mean number of reads per million)
...............AAACUCUACUUGUCCUUCUGAGU............................................................  3         0.36
CUCUUGUUCACAGCCAAACUCUACUUGUCCUUCUGAGUGUAAUUACGUACAUGCAGUAGCUCAGGAGACAAGCAGGUUUACCCUGUGGAUGAGUCUGA
..((..(((((((..((((.((.((((((.((((((((.....(((((....)).))))))))))))))))).))))))...)))))))..))..... (-34.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000105 3 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).