Deep sequencing reads for stem-loop sequence MI0003823

Stem-loop ID hsa-mir-449c
Reads 
                hsa-miR-449c-5p                        hsa-miR-449c-3p                        Count     RPM (mean number of reads per million)
................UAGGCAGUGUAUUGCUAGCGG.......................................................  1         23.2
GCUGGGAUGUGUCAGGUAGGCAGUGUAUUGCUAGCGGCUGUUAAUGAUUUUAACAGUUGCUAGUUGCACUCCUCUCUGUUGCAUUCAGAAGC
(((.(((((((.(((..(((.((((((..(((((((((((((((.....))))))))))))))))))))))))..))).)))))))...))) (-46.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000264 1 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).