Deep sequencing reads for stem-loop sequence MI0009959

Stem-loop ID mmu-mir-1962
Reads 
                                                                          mmu-miR-1962                                     Count     RPM (mean number of reads per million)
...............................UGGUCCCAUCUGUCUGCCUCUCU...................................................................  1         0.0744
....................................................................AUGGAGAGGCUGGCACUGGGACACAUG..........................  1         0.0264
........................................................................AGAGGCUGGCACUGGGACACA............................  21        0.393
........................................................................AGAGGCUGGCACUGGGACACAU...........................  19        0.318
........................................................................AGAGGCUGGCACUGGGACAC.............................  3         0.051
........................................................................AGAGGCUGGCACUGGGACA..............................  2         0.116
........................................................................AGAGGCUGGCACUGGGACACAUG..........................  1         0.0264
........................................................................AGAGGCUGGCACUGGGAC...............................  1         0.0123
UGUGGCAUUUGCAAACUAUGUAGUCAGUCAGUGGUCCCAUCUGUCUGCCUCUCUCUCGUUCAGUUUCCAUGGAGAGGCUGGCACUGGGACACAUGACUGAUGGUAUGCUCCCCGCUGCAGU
((..((....(((.(((.....((((((((...((((((..((((.((((((((...(........)...)))))))).)))).))))))...))))))))))).))).....))..)).. (-51.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000062 1embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000221 1spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 1spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 1spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 1spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000229 6bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 1bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 22bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 2peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 1peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000236 14spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000241 2lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000258 1testes GEO : GSM539877 strain: C57BL/6J, gender: male
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).