Deep sequencing reads for stem-loop sequence MI0010552

Stem-loop ID osa-MIR2092
Reads 
        osa-miR2092-5p                                                       osa-miR2092-3p              Count     RPM (mean number of reads per million)
UUGAUCUCCCAACUGAAGUCGGUGUUUACUCCCACAAGAUGAUACACUACUAGUCCACCCUUAUCAAUUGUAGUACACACCAGCAUUCCAUUGGCAGAGGUGU
...(((((((((..(((((.(((((.((((...((((..(((((.................))))).)))))))).))))).)).)))..))))..))))).. (-24.93)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000201 24whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:21113019 "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)" Li T, Li H, Zhang YX, Liu JY Nucleic Acids Res. 39:2821-2833(2011).