Deep sequencing reads for stem-loop sequence MI0012379

Stem-loop ID bmo-mir-2803
Reads 
            bmo-miR-2803                                                         Count     RPM (mean number of reads per million)
..........UGGACGUUACCAAUGCCAGGGA...............................................  5         1.75
CCAUGGCUUAUGGACGUUACCAAUGCCAGGGACAGAGCCAAGCCGCUUCCUAGCAUUGAGUACUCUCCGCAGGCCUCGU
....(((((.((((.(.(((((((((.(((((..(.((...)))..))))).)))))).))).).)))).))))).... (-27.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000269 8anterior silk glands GEO : GSM449726 5th-instar day-3 larvae [ Liu S et al.]
ER0000000270 2posterior silk glands GEO : GSM449727 5th-instar day-3 larvae [ Liu S et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).