Deep sequencing reads for stem-loop sequence MI0014131

Stem-loop ID hsa-mir-3118-1
Reads 
                                             hsa-miR-3118                   Count     RPM (mean number of reads per million)
...........................................UGUGACUGCAUUAUGAAAAUUC..........  5         1.04
CACACUACAAUAAUUUUCAUAAUGCAAUCACACAUAAUCACUAUGUGACUGCAUUAUGAAAAUUCUUGUAGUGUG
((((((((((.(((((((((((((((.(((((...........))))).))))))))))))))).)))))))))) (-37.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000108 2melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 4melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 3melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).