Deep sequencing reads for stem-loop sequence MI0016064

Stem-loop ID hsa-mir-3663
Reads 
                  hsa-miR-3663-5p                       hsa-miR-3663-3p                            Count     RPM (mean number of reads per million)
....................GCUGGUCUGCGUGGUGCUCGG........................................................  2         0.508
CCCGGGACCUUGGUCCAGGCGCUGGUCUGCGUGGUGCUCGGGUGGAUAAGUCUGAUCUGAGCACCACACAGGCCGGGCGCCGGGACCAAGGGGGCUC
(((....(((((((((.((((((((((((.((((((((((((((((....))).))))))))))))).)))))).)))))).))))))))))))... (-69.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 1embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000110 4melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).