Deep sequencing reads for stem-loop sequence MI0016318

Stem-loop ID tca-mir-3847
Reads 
             tca-miR-3847-5p                            tca-miR-3847-3p                            Count     RPM (mean number of reads per million)
GAAGUGCUGUUUAAAUUCGAACUUUUUAUUUAAUUUGGCAAUGUGUGCGAGUUACACGUCUCGAAUUUCGAUCAGGUUCGAUUUUAACCGGCUUAAA
.....((((.(((((.((((((((.......(((((((..(((((((.....))))))).)))))))......)))))))).))))).))))..... (-27.12)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000199 32adult GEO : GSM639446 genotype: wild type, gender: male and female [ Marco A et al.]
ER0000000200 2embryo GEO : GSM639447 genotype: wild type, age: 0-5 days, gender: male and female [ Marco A et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).