Deep sequencing reads for stem-loop sequence MI0016761

Stem-loop ID hsa-mir-378g
Reads 
  hsa-miR-378g                             Count     RPM (mean number of reads per million)
.ACUGGGCUUGGAGUCAGAAG....................  8         0.17
....GGGCUUGGAGUCAGAAG....................  1         48.5
CACUGGGCUUGGAGUCAGAAGACCUGGCUCCAGCCCAGCUC
..(((((((.((((((((.....)))))))))))))))... (-27.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 10embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 98601melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 17922melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 1089 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 14016melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 8315melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 26111melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 29111melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 13718melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 30908melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 41276melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 4611melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 19506melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000138 1squamous cell GEO : GSM532874 [ Witten D et al.]
ER0000000140 1squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000144 1squamous cell GEO : GSM532880 [ Witten D et al.]
ER0000000150 1squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000154 1squamous cell GEO : GSM532890 [ Witten D et al.]
ER0000000158 1squamous cell GEO : GSM532894 [ Witten D et al.]
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000180 1squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000186 1squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000193 1 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000262 60 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 21 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 28 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 18 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 156 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 56 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).