Deep sequencing reads for stem-loop sequence MI0016790

Stem-loop ID hsa-mir-4447
Reads 
                                                             hsa-miR-4447                   Count     RPM (mean number of reads per million)
GUUCUAGAGCAUGGUUUCUCAUCAUUUGCACUACUGAUACUUGGGGUCAGAUAAUUGUUUGUGGUGGGGGCUGUUGUUUGCAUUGUAGGAU
(((((((((((((((..(.((((((..(((.(((((((.......))))).))..)))..)))))))..)))).)))))......)))))) (-23.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000109 2melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).