Deep sequencing reads for stem-loop sequence MI0017538

Stem-loop ID cel-mir-4808
Reads
cel-miR-4808-5p                     cel-miR-4808-3p          Count     RPM (mean number of reads per million)
....................................AAGCUCUAUUCUCUCUUACAG  1         18.6
GUAAGAUAGAUUAGUGCUUUCAAUUAUUUCAAACGAAAGCUCUAUUCUCUCUUACAG
((((((.(((.(((.((((((.............)))))).))).))).)))))).. (-20.32)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000203 1adult GEO : GSM604032 strain: N2 wild-type, age: Day 0 [ de Lencastre A et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).