Deep sequencing reads for stem-loop sequence MI0019197

Stem-loop ID mmu-mir-344h-2
Reads 
mmu-miR-344h-5p                        mmu-miR-344h-3p           Count     RPM (mean number of reads per million)
.......................................GUAUAACCAAAGCCCGACUGU  1         0.347
CAGGCUUCUGGCUAUAUUCCAGGACAUACCUGGUCCUGGGUAUAACCAAAGCCCGACUGU
..(((((.(((.(((((.(((((((.......)))))))))))).))))))))....... (-25.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000038 1brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 1brain GEO : GSM510444 [ Chiang HR et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).