Deep sequencing reads for mature sequence MIMAT0000068

Stem-loop ID hsa-mir-15a
Mature ID hsa-miR-15a-5p
Reads 
             hsa-miR-15a-5p                       hsa-miR-15a-3p                      Count     RPM (mean number of reads per million)
.........AAAGUAGCAGCACAUAAUGGUUUGU.................................................  7         15.6
.........AAAGUAGCAGCACAUAAUGGUUUG..................................................  4         11.5
.........AAAGUAGCAGCACAUAAUGGUUU...................................................  2         7.1
.........AAAGUAGCAGCACAUAAUGGUU....................................................  1         2
.........AAAGUAGCAGCACAUAAUGGUUUGUG................................................  1         1.54
............GUAGCAGCACAUAAUGGUUUG..................................................  1         1.58
............GUAGCAGCACAUAAUGGUUUGU.................................................  1         1.68
............GUAGCAGCACAUAAUGGUUU...................................................  1         1.58
.............UAGCAGCACAUAAUGGUUUGUG................................................  924       84
.............UAGCAGCACAUAAUGGUUUGU.................................................  883       611
.............UAGCAGCACAUAAUGGUUUGUGGA..............................................  228       4.35
.............UAGCAGCACAUAAUGGUUUG..................................................  135       107
.............UAGCAGCACAUAAUGGUUU...................................................  99        225
.............UAGCAGCACAUAAUGGUUUGUGG...............................................  68        37.5
.............UAGCAGCACAUAAUGGUUUGUGGAU.............................................  17        6.94
.............UAGCAGCACAUAAUGGUU....................................................  2         0.0164
..............AGCAGCACAUAAUGGUUUGU.................................................  2         0.043
.................................................GCAGGCCAUAUUGUGCUGCCUCA...........  1         0.119
..................................................CAGGCCAUAUUGUGCUGCCUCA...........  13        1.17
..................................................CAGGCCAUAUUGUGCUGCCU.............  8         0.135
..................................................CAGGCCAUAUUGUGCUGCCUC............  3         0.154
CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG
(((((.......(..((((((((..((((((((((..((.....))..))))))))))..))))))))..).......))))) (-30.74)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 25embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 68embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 262melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 34melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 147 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 71melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 288melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 495melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 133melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 291melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 1092melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 402melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 169melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 250melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000138 3squamous cell GEO : GSM532874 [ Witten D et al.]
ER0000000139 11 GEO : GSM532875 normal cervix [ Witten D et al.]
ER0000000140 2squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000149 61 GEO : GSM532885 normal cervix [ Witten D et al.]
ER0000000150 1squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000155 153 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000156 2squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000159 411 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000163 108 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000164 5squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000167 351 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000168 1adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000173 77 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000174 3squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000177 488 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000179 61 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000180 2squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000185 110 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000186 3squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000187 36 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000188 3squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000193 1 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 2squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 161 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 307 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 356 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 16 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 35 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 2 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).