Deep sequencing reads for mature sequence MIMAT0000107

Stem-loop ID dme-mir-2b-1
Mature ID dme-miR-2b-3p
Confidence Annotation confidence: high
Reads
       dme-miR-2b-1-5p                          dme-miR-2b-3p                  Count     RPM (mean number of reads per million)
.......UGUCUUCAAAGUGGCAGUGACA................................................  2         0.0159
........GUCUUCAAAGUGGCAGUGACAUG..............................................  341       25.6
........GUCUUCAAAGUGGCAGUGACA................................................  328       5.75
........GUCUUCAAAGUGGCAGUGAC.................................................  277       3.55
........GUCUUCAAAGUGGCAGUGACAU...............................................  65        3.5
........GUCUUCAAAGUGGCAGUGACAUGU.............................................  2         0.124
........GUCUUCAAAGUGGCAGU....................................................  1         0.00666
.........UCUUCAAAGUGGCAGUGACAUG..............................................  3         0.145
..........CUUCAAAGUGGCAGUGACAUG..............................................  1         0.0483
...........UUCAAAGUGGCAGUGACAUG..............................................  2         0.0159
...........UUCAAAGUGGCAGUGAC.................................................  1         0.00666
............UCAAAGUGGCAGUGACAUG..............................................  1         0.0828
.............................UGUUGUCAACAAUAUUCAUA............................  4         0.0414
.............................UGUUGUCAACAAUAUUCAU.............................  3         0.0347
.............................UGUUGUCAACAAUAUUCAUAUCAC........................  2         0.0159
..............................GUUGUCAACAAUAUUCAUA............................  2         0.0159
...............................UUGUCAACAAUAUUCAUA............................  2         0.0159
..................................UCAACAAUAUUCAUAUCACAGCCAGC.................  1         0.0412
...........................................UUCAUAUCACAGCCAGCUUUGAGG..........  1         0.0791
..............................................AUAUCACAGCCAGCUUUGAGGAG........  87        4.07
..............................................AUAUCACAGCCAGCUUUGAGGAGCG......  76        7.47
..............................................AUAUCACAGCCAGCUUUGAGGAGC.......  54        3.95
..............................................AUAUCACAGCCAGCUUUGAGGAGCGUU....  14        0.0994
..............................................AUAUCACAGCCAGCUUUGAGGAGCGU.....  11        0.402
..............................................AUAUCACAGCCAGCUUUGAGG..........  10        0.199
..............................................AUAUCACAGCCAGCUUUGAGGA.........  8         0.871
..............................................AUAUCACAGCCAGCUUUG.............  1         0.0828
...............................................UAUCACAGCCAGCUUUGAGGAG........  233341    6.82e+03
...............................................UAUCACAGCCAGCUUUGAGGAGCG......  138004    5.26e+03
...............................................UAUCACAGCCAGCUUUGAGGAGC.......  121738    3.53e+03
...............................................UAUCACAGCCAGCUUUGAGGA.........  23885     753
...............................................UAUCACAGCCAGCUUUGAGGAGCGU.....  18128     406
...............................................UAUCACAGCCAGCUUUGAGG..........  8404      219
...............................................UAUCACAGCCAGCUUUGAG...........  1174      27.5
...............................................UAUCACAGCCAGCUUUGAGGAGCGUU....  626       10.6
...............................................UAUCACAGCCAGCUUUGA............  513       18.8
...............................................UAUCACAGCCAGCUUUG.............  56        1.02
...............................................UAUCACAGCCAGCUUUGAGGAGCGUUG...  8         0.176
................................................AUCACAGCCAGCUUUGAGGAGCG......  1765      24.3
................................................AUCACAGCCAGCUUUGAGGAGC.......  1023      14.6
................................................AUCACAGCCAGCUUUGAGGAG........  640       13.2
................................................AUCACAGCCAGCUUUGAGGAGCGU.....  344       3.25
................................................AUCACAGCCAGCUUUGAGGA.........  75        3.59
................................................AUCACAGCCAGCUUUGAGG..........  29        0.677
................................................AUCACAGCCAGCUUUGAGGAGCGUU....  17        0.124
................................................AUCACAGCCAGCUUUGAG...........  3         0.0579
................................................AUCACAGCCAGCUUUGA............  3         0.0394
.................................................UCACAGCCAGCUUUGAGGAGCGU.....  1192      32.6
.................................................UCACAGCCAGCUUUGAGGAG........  797       27.7
.................................................UCACAGCCAGCUUUGAGGAGCG......  791       30.7
.................................................UCACAGCCAGCUUUGAGGAGC.......  539       18.5
.................................................UCACAGCCAGCUUUGAGGA.........  75        4.3
.................................................UCACAGCCAGCUUUGAGGAGCGUU....  55        1.41
.................................................UCACAGCCAGCUUUGAGG..........  28        0.588
.................................................UCACAGCCAGCUUUGAG...........  6         1.41
.................................................UCACAGCCAGCUUUGAGGAGCGUUG...  2         0.0159
..................................................CACAGCCAGCUUUGAGGAG........  95        2.14
..................................................CACAGCCAGCUUUGAGGAGCG......  74        5.44
..................................................CACAGCCAGCUUUGAGGAGC.......  60        0.772
..................................................CACAGCCAGCUUUGAGGA.........  17        1.5
..................................................CACAGCCAGCUUUGAGG..........  17        0.175
..................................................CACAGCCAGCUUUGAGGAGCGU.....  13        0.133
..................................................CACAGCCAGCUUUGAGGAGCGUU....  2         0.0279
...................................................ACAGCCAGCUUUGAGGAG........  3142      57
...................................................ACAGCCAGCUUUGAGGAGC.......  1871      30.7
...................................................ACAGCCAGCUUUGAGGAGCG......  1684      31.7
...................................................ACAGCCAGCUUUGAGGAGCGU.....  391       5.38
...................................................ACAGCCAGCUUUGAGGA.........  256       4.06
...................................................ACAGCCAGCUUUGAGGAGCGUU....  16        0.57
....................................................CAGCCAGCUUUGAGGAG........  82        1.95
....................................................CAGCCAGCUUUGAGGAGCG......  79        3.86
....................................................CAGCCAGCUUUGAGGAGC.......  32        1.37
....................................................CAGCCAGCUUUGAGGAGCGU.....  17        0.334
.....................................................AGCCAGCUUUGAGGAGCG......  404       21.4
.....................................................AGCCAGCUUUGAGGAGCGU.....  105       3.08
.....................................................AGCCAGCUUUGAGGAGC.......  28        0.63
.....................................................AGCCAGCUUUGAGGAGCGUU....  3         0.0294
......................................................GCCAGCUUUGAGGAGCG......  104       9.08
......................................................GCCAGCUUUGAGGAGCGU.....  20        2.06
......................................................GCCAGCUUUGAGGAGCGUU....  1         0.019
.......................................................CCAGCUUUGAGGAGCGU.....  3         0.232
CUUCAACUGUCUUCAAAGUGGCAGUGACAUGUUGUCAACAAUAUUCAUAUCACAGCCAGCUUUGAGGAGCGUUGCGG
((.((((..(((((((((((((.((((.((((((....)))))).....)))).)))).)))))))))..)))).)) (-27.90)
Stem-loop ID dme-mir-2b-2
Mature ID dme-miR-2b-3p
Confidence Annotation confidence: high
Reads
       dme-miR-2b-2-5p                                dme-miR-2b-3p                  Count     RPM (mean number of reads per million)
.......AUUCUUCAAAGUGGUUGUGAAAU.....................................................  4         0.122
.......AUUCUUCAAAGUGGUUGUGAAAUG....................................................  3         0.824
........UUCUUCAAAGUGGUUGUGAAAUG....................................................  7038      421
........UUCUUCAAAGUGGUUGUGAAAU.....................................................  4711      163
........UUCUUCAAAGUGGUUGUGAAA......................................................  1717      68.4
........UUCUUCAAAGUGGUUGUGAA.......................................................  767       22.6
........UUCUUCAAAGUGGUUGUGA........................................................  452       12.4
........UUCUUCAAAGUGGUUGUGAAAUGU...................................................  112       5.3
........UUCUUCAAAGUGGUUGUG.........................................................  59        2.34
........UUCUUCAAAGUGGUUGU..........................................................  54        2.36
........UUCUUCAAAGUGGUUGUGAAAUGUU..................................................  19        0.345
........UUCUUCAAAGUGGUUGUGAAAUGUUU.................................................  2         0.594
........UUCUUCAAAGUGGUUGUGAAAUGUUUGC...............................................  1         0.00436
........UUCUUCAAAGUGGUUGUGAAAUGUUUGCC..............................................  1         0.00666
.........UCUUCAAAGUGGUUGUGAAAUG....................................................  934       63.2
.........UCUUCAAAGUGGUUGUGAAAU.....................................................  257       12.5
.........UCUUCAAAGUGGUUGUGAAA......................................................  97        2.38
.........UCUUCAAAGUGGUUGUGAA.......................................................  22        0.376
.........UCUUCAAAGUGGUUGUGAAAUGU...................................................  11        0.228
.........UCUUCAAAGUGGUUGUGA........................................................  10        0.131
.........UCUUCAAAGUGGUUGUGAAAUGUUU.................................................  3         0.0347
..........CUUCAAAGUGGUUGUGAAAUG....................................................  14        0.626
..........CUUCAAAGUGGUUGUGAA.......................................................  3         0.0347
..........CUUCAAAGUGGUUGUGAAAU.....................................................  2         0.0159
...........UUCAAAGUGGUUGUGAAAU.....................................................  9         0.763
...........UUCAAAGUGGUUGUGAAAUG....................................................  8         0.65
...........UUCAAAGUGGUUGUGAAA......................................................  2         0.0159
............UCAAAGUGGUUGUGAAAUG....................................................  21        1.24
............UCAAAGUGGUUGUGAAA......................................................  4         0.0292
............UCAAAGUGGUUGUGAAAU.....................................................  4         0.0615
.............CAAAGUGGUUGUGAAAUG....................................................  6         0.799
.............CAAAGUGGUUGUGAAAU.....................................................  5         0.0553
..............................GUUUGCCUUUUUAUGCCUAUUC...............................  1         0.0412
...............................UUUGCCUUUUUAUGCCUAUUCA..............................  386       27.3
...............................UUUGCCUUUUUAUGCCUAUUC...............................  18        1.08
...............................UUUGCCUUUUUAUGCCU...................................  1         0.00666
...............................UUUGCCUUUUUAUGCCUAUU................................  1         0.0577
................................UUGCCUUUUUAUGCCUAUUCA..............................  6         0.0426
.................................UGCCUUUUUAUGCCUAUUCA..............................  1         0.0361
..................................GCCUUUUUAUGCCUAUUCA..............................  2         0.0381
.................................................UUCAUAUCACAGCCAGCUUUGAGG..........  1         0.0791
....................................................AUAUCACAGCCAGCUUUGAGGAG........  87        4.07
....................................................AUAUCACAGCCAGCUUUGAGGAGCG......  76        7.47
....................................................AUAUCACAGCCAGCUUUGAGGAGC.......  54        3.95
....................................................AUAUCACAGCCAGCUUUGAGG..........  10        0.199
....................................................AUAUCACAGCCAGCUUUGAGGA.........  8         0.871
....................................................AUAUCACAGCCAGCUUUGAGGAGCGA.....  1         0.0326
....................................................AUAUCACAGCCAGCUUUG.............  1         0.0828
.....................................................UAUCACAGCCAGCUUUGAGGAG........  233341    6.82e+03
.....................................................UAUCACAGCCAGCUUUGAGGAGCG......  138004    5.26e+03
.....................................................UAUCACAGCCAGCUUUGAGGAGC.......  121738    3.53e+03
.....................................................UAUCACAGCCAGCUUUGAGGA.........  23885     753
.....................................................UAUCACAGCCAGCUUUGAGG..........  8404      219
.....................................................UAUCACAGCCAGCUUUGAGGAGCGA.....  2345      54.6
.....................................................UAUCACAGCCAGCUUUGAG...........  1174      27.5
.....................................................UAUCACAGCCAGCUUUGA............  513       18.8
.....................................................UAUCACAGCCAGCUUUG.............  56        1.02
.....................................................UAUCACAGCCAGCUUUGAGGAGCGAC....  12        0.129
......................................................AUCACAGCCAGCUUUGAGGAGCG......  1765      24.3
......................................................AUCACAGCCAGCUUUGAGGAGC.......  1023      14.6
......................................................AUCACAGCCAGCUUUGAGGAG........  640       13.2
......................................................AUCACAGCCAGCUUUGAGGA.........  75        3.59
......................................................AUCACAGCCAGCUUUGAGGAGCGA.....  37        0.346
......................................................AUCACAGCCAGCUUUGAGG..........  29        0.677
......................................................AUCACAGCCAGCUUUGAG...........  3         0.0579
......................................................AUCACAGCCAGCUUUGA............  3         0.0394
.......................................................UCACAGCCAGCUUUGAGGAG........  797       27.7
.......................................................UCACAGCCAGCUUUGAGGAGCG......  791       30.7
.......................................................UCACAGCCAGCUUUGAGGAGC.......  539       18.5
.......................................................UCACAGCCAGCUUUGAGGAGCGA.....  93        2.37
.......................................................UCACAGCCAGCUUUGAGGA.........  75        4.3
.......................................................UCACAGCCAGCUUUGAGG..........  28        0.588
.......................................................UCACAGCCAGCUUUGAG...........  6         1.41
........................................................CACAGCCAGCUUUGAGGAG........  95        2.14
........................................................CACAGCCAGCUUUGAGGAGCG......  74        5.44
........................................................CACAGCCAGCUUUGAGGAGC.......  60        0.772
........................................................CACAGCCAGCUUUGAGGA.........  17        1.5
........................................................CACAGCCAGCUUUGAGG..........  17        0.175
........................................................CACAGCCAGCUUUGAGGAGCGA.....  8         0.0791
.........................................................ACAGCCAGCUUUGAGGAG........  3142      57
.........................................................ACAGCCAGCUUUGAGGAGC.......  1871      30.7
.........................................................ACAGCCAGCUUUGAGGAGCG......  1684      31.7
.........................................................ACAGCCAGCUUUGAGGA.........  256       4.06
.........................................................ACAGCCAGCUUUGAGGAGCGA.....  52        0.944
..........................................................CAGCCAGCUUUGAGGAG........  82        1.95
..........................................................CAGCCAGCUUUGAGGAGCG......  79        3.86
..........................................................CAGCCAGCUUUGAGGAGC.......  32        1.37
...........................................................AGCCAGCUUUGAGGAGCG......  404       21.4
...........................................................AGCCAGCUUUGAGGAGC.......  28        0.63
...........................................................AGCCAGCUUUGAGGAGCGA.....  19        1.2
............................................................GCCAGCUUUGAGGAGCG......  104       9.08
............................................................GCCAGCUUUGAGGAGCGA.....  6         0.873
.............................................................CCAGCUUUGAGGAGCGA.....  2         0.0959
UUGUGUCAUUCUUCAAAGUGGUUGUGAAAUGUUUGCCUUUUUAUGCCUAUUCAUAUCACAGCCAGCUUUGAGGAGCGACGCGA
(((((((.(((((((((((((((((((.(((...((........)).....))).))))))))).)))))))))).))))))) (-36.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000010 10557head GEO : GSM240749 [ Chung WJ et al.]
ER0000000011 15743S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 18171S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 31514Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000014 5346imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000015 8931head GEO : GSM286601 [ Chung WJ et al.]
ER0000000016 1938whole body GEO : GSM286602 [ Chung WJ et al.]
ER0000000017 1835whole body GEO : GSM286603 [ Chung WJ et al.]
ER0000000018 11926embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000019 15345embryo GEO : GSM286605 [ Chung WJ et al.]
ER0000000020 7704embryo GEO : GSM286606 [ Chung WJ et al.]
ER0000000021 34366embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000022 36052embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000023 7300embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000079 4693whole body GEO : GSM322208 3rd instar larvae
ER0000000080 6659whole body GEO : GSM322219 2-4 day old pupae
ER0000000081 1841whole body GEO : GSM322245 3rd instar larvae
ER0000000082 1600whole body GEO : GSM322338 2-4 day old pupae
ER0000000083 21799head GEO : GSM322533 adult female head
ER0000000084 78077head GEO : GSM322543 adult male head
ER0000000085 2069whole body GEO : GSM360256 1st instar larvae
ER0000000086 2752whole body GEO : GSM360257 1st instar larvae
ER0000000087 12165whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 20770whole body GEO : GSM360262 0-2 day old pupae
ER0000000089 6133embryo GEO : GSM364902 12-24hr embryo
ER0000000090 19842whole body GEO : GSM280082 from 2-4 day old flies
ER0000000091 19540whole body GEO : GSM280083 from 2-4 day old flies
ER0000000092 34282whole body GEO : GSM280084 from 2-4 day old flies
ER0000000093 19251whole body GEO : GSM280085 from 2-4 day old flies
ER0000000094 2126whole body GEO : GSM280086 from 2-4 day old flies
ER0000000095 2817S2 cell GEO : GSM280087
ER0000000096 230151S2 cell GEO : GSM280088
ER0000000099 7007imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000100 7301whole body GEO : GSM399106 female body
ER0000000101 16875whole body GEO : GSM399107 male body
ER0000000102 425109S2 cell GEO : GSM371638
ER0000000115 2837head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]
ER0000000116 508whole body GEO : GSM180329 adult bodies (female bodies, male bodies) [ Ruby JG et al.]
ER0000000117 510embryo GEO : GSM180330 very early embryo (0-1) [ Ruby JG et al.]
ER0000000118 1192embryo GEO : GSM180331 early embryo (2-6) [ Ruby JG et al.]
ER0000000119 1976embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]
ER0000000120 1646embryo GEO : GSM180333 late embryo (12-24) [ Ruby JG et al.]
ER0000000121 385whole body GEO : GSM180334 larvae: 1st instar and 3rd instars [ Ruby JG et al.]
ER0000000122 901imaginal disc GEO : GSM180335 [ Ruby JG et al.]
ER0000000123 397whole body GEO : GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day [ Ruby JG et al.]
ER0000000124 1509S2 cell GEO : GSM180337 tissue culture cells (S2 only) [ Ruby JG et al.]
ER0000000127 50351ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 101061ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 141893ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells
ER0000000130 29700ovary GEO : GSM385822 Ovary Somatic Sheet (OSS) cells
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:18501606 "Endogenous RNA interference provides a somatic defense against Drosophila transposons" Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).