Deep sequencing reads for mature sequence MIMAT0000404

Stem-loop IDdme-mir-312
Mature IDdme-miR-312-3p
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
    dme-miR-312-5p                       dme-miR-312-3p             Count     RPM (mean number of reads per million)
....UGGUUCGUCACAAGGGCAAUUCU.......................................  2514      265
....UGGUUCGUCACAAGGGCAAUUC........................................  1143      143
....UGGUUCGUCACAAGGGCAAUU.........................................  418       40
....UGGUUCGUCACAAGGGCAAU..........................................  156       14.4
....UGGUUCGUCACAAGGGCAA...........................................  51        4.82
....UGGUUCGUCACAAGGGCA............................................  13        1.1
....UGGUUCGUCACAAGGGC.............................................  7         0.544
....UGGUUCGUCACAAGGGCAAUUCUGC.....................................  2         0.184
....UGGUUCGUCACAAGGGCAAUUCUG......................................  1         0.14
.....GGUUCGUCACAAGGGCAAUUCU.......................................  9         0.457
.....GGUUCGUCACAAGGGCAAUUC........................................  2         0.461
.......UUCGUCACAAGGGCAAUUCU.......................................  4         0.208
.......UUCGUCACAAGGGCAAUUC........................................  2         0.306
.......UUCGUCACAAGGGCAAUU.........................................  1         0.0542
........UCGUCACAAGGGCAAUUCU.......................................  2         0.306
........UCGUCACAAGGGCAAUUC........................................  1         0.23
.........CGUCACAAGGGCAAUUCU.......................................  1         0.0756
......................................CUAGUAUUGCACUUGAGACGGCCUG...  5         0.404
.........................................GUAUUGCACUUGAGACGGCCUG...  1         0.14
..........................................UAUUGCACUUGAGACGGCCUGA..  22290     2.07e+03
..........................................UAUUGCACUUGAGACGGCCUG...  5189      494
..........................................UAUUGCACUUGAGACGGCCU....  1347      125
..........................................UAUUGCACUUGAGACGGCCUGAU.  383       42.5
..........................................UAUUGCACUUGAGACGGCC.....  130       12.3
..........................................UAUUGCACUUGAGACGGC......  80        5.98
..........................................UAUUGCACUUGAGACGGCCUGAUU  12        1.56
..........................................UAUUGCACUUGAGACGG.......  7         0.56
...........................................AUUGCACUUGAGACGGCCUGA..  69        4.77
...........................................AUUGCACUUGAGACGGCCUG...  19        1.16
...........................................AUUGCACUUGAGACGGCCUGAU.  12        0.731
...........................................AUUGCACUUGAGACGGCCU....  3         0.347
...........................................AUUGCACUUGAGACGGCCUGAUU  1         0.035
............................................UUGCACUUGAGACGGCCUGA..  66        4.45
............................................UUGCACUUGAGACGGCCUG...  8         0.644
............................................UUGCACUUGAGACGGCCUGAU.  2         0.164
.............................................UGCACUUGAGACGGCCUGA..  23        2.68
.............................................UGCACUUGAGACGGCCU....  2         0.12
..............................................GCACUUGAGACGGCCUGA..  27        2.58
..............................................GCACUUGAGACGGCCUG...  4         0.325
...............................................CACUUGAGACGGCCUGA..  4         0.31
GAUUUGGUUCGUCACAAGGGCAAUUCUGCAUUUUUUAACUAGUAUUGCACUUGAGACGGCCUGAUU
((((.(((.((((.((((.(((((.(((...........))).))))).)))).))))))).)))) (-20.00)

Filter reads

by experiment
AccessionRead countTissueLinkCommentReference
ER0000000010 67HeadGEO : GSM240749 [ Chung WJ et al.]
ER0000000011 33S2 cellGEO : GSM272651 [ Chung WJ et al.]
ER0000000012 4S2 cellGEO : GSM272652 [ Chung WJ et al.]
ER0000000013 6Kc cellGEO : GSM272653 [ Chung WJ et al.]
ER0000000014 884Imaginal discGEO : GSM275691 [ Chung WJ et al.]
ER0000000015 3HeadGEO : GSM286601 [ Chung WJ et al.]
ER0000000016 62Whole bodyGEO : GSM286602 [ Chung WJ et al.]
ER0000000017 734Whole bodyGEO : GSM286603 [ Chung WJ et al.]
ER0000000018 2831EmbryoGEO : GSM286604 [ Chung WJ et al.]
ER0000000019 6825EmbryoGEO : GSM286605 [ Chung WJ et al.]
ER0000000020 2105EmbryoGEO : GSM286606 [ Chung WJ et al.]
ER0000000021 4760EmbryoGEO : GSM286607 [ Chung WJ et al.]
ER0000000022 4324EmbryoGEO : GSM286611 [ Chung WJ et al.]
ER0000000023 7848EmbryoGEO : GSM286613 [ Chung WJ et al.]
ER0000000079 42Whole bodyGEO : GSM3222083rd instar larvae
ER0000000080 62Whole bodyGEO : GSM3222192-4 day old pupae
ER0000000081 13Whole bodyGEO : GSM3222453rd instar larvae
ER0000000082 7Whole bodyGEO : GSM3223382-4 day old pupae
ER0000000083 113HeadGEO : GSM322533Age: Adult; Gender: Female
ER0000000084 195HeadGEO : GSM322543Age: Adult; Gender: Male
ER0000000085 15Whole bodyGEO : GSM3602561st instar larvae
ER0000000086 12Whole bodyGEO : GSM3602571st instar larvae
ER0000000087 86Whole bodyGEO : GSM3602600-1 day old pupae
ER0000000088 145Whole bodyGEO : GSM3602620-2 day old pupae
ER0000000089 186EmbryoGEO : GSM364902Age: 12-24 hours
ER0000000090 1459Whole bodyGEO : GSM280082Age: 2-4 days
ER0000000091 2928Whole bodyGEO : GSM280083Age: 2-4 days
ER0000000092 1617Whole bodyGEO : GSM280084Age: 2-4 days
ER0000000093 1622Whole bodyGEO : GSM280085Age: 2-4 days
ER0000000094 500Whole bodyGEO : GSM280086Age: 2-4 days
ER0000000095 15S2 cellGEO : GSM280087
ER0000000096 6S2 cellGEO : GSM280088
ER0000000099 1128Imaginal discGEO : GSM399105Imaginal disc/brain
ER0000000100 2499Whole bodyGEO : GSM399106Gender: Female
ER0000000101 430Whole bodyGEO : GSM399107Gender: Male
ER0000000102 6S2 cellGEO : GSM371638
ER0000000115 11HeadGEO : GSM180328Age: Adult; Gender: Female & male[ Ruby JG et al.]
ER0000000116 59Whole bodyGEO : GSM180329Age: Adult; Gender: Female & male[ Ruby JG et al.]
ER0000000117 339EmbryoGEO : GSM180330Very early embryo (0-1)[ Ruby JG et al.]
ER0000000118 595EmbryoGEO : GSM180331Early embryo (2-6)[ Ruby JG et al.]
ER0000000119 235EmbryoGEO : GSM180332Mid embryo (6-10)[ Ruby JG et al.]
ER0000000120 48EmbryoGEO : GSM180333Late embryo (12-24)[ Ruby JG et al.]
ER0000000121 2Whole bodyGEO : GSM180334Larvae: 1st instar and 3rd instar[ Ruby JG et al.]
ER0000000122 115Imaginal discGEO : GSM180335 [ Ruby JG et al.]
ER0000000123 2Whole bodyGEO : GSM180336Pupae: 0-1 day, 0-2 day, 2-4 day[ Ruby JG et al.]
ER0000000127 1OvaryGEO : GSM385744Ovary Somatic Sheet (OSS) cells
ER0000000128 3OvaryGEO : GSM385748Ovary Somatic Sheet (OSS) cells
ER0000000129 3OvaryGEO : GSM385821Ovary Somatic Sheet (OSS) cells
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:18501606 "Endogenous RNA interference provides a somatic defense against Drosophila transposons" Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).