Deep sequencing reads for mature sequence MIMAT0003294

Stem-loop ID hsa-mir-625
Mature ID hsa-miR-625-5p
Reads 
             hsa-miR-625-5p                       hsa-miR-625-3p                       Count     RPM (mean number of reads per million)
..............AGGGGGAAAGUUCUAUAGUCCU.................................................  110       4.53
..............AGGGGGAAAGUUCUAUAGUCC..................................................  28        1.46
..............AGGGGGAAAGUUCUAUAGUC...................................................  26        1.74
..............AGGGGGAAAGUUCUAUAGU....................................................  9         0.525
..............AGGGGGAAAGUUCUAUAGUCCUG................................................  6         0.121
..............AGGGGGAAAGUUCUAUAG.....................................................  2         0.0856
...................................................GACUAUAGAACUUUCCCCCUCA............  80        3.34
...................................................GACUAUAGAACUUUCCCCCUC.............  11        0.509
...................................................GACUAUAGAACUUUCCCCCUCAU...........  7         0.162
....................................................ACUAUAGAACUUUCCCCCUCA............  18        0.917
....................................................ACUAUAGAACUUUCCCCCUCAU...........  2         0.0674
AGGGUAGAGGGAUGAGGGGGAAAGUUCUAUAGUCCUGUAAUUAGAUCUCAGGACUAUAGAACUUUCCCCCUCAUCCCUCUGCCCU
(((((((((((((((((((((((((((((((((((((...........))))))))))))))))))))))))))))))))))))) (-74.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 1embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 10embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 103melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 12melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 46 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 7melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 40melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 20melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 12melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 34melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 35melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 30melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 57melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 5melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000150 1squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000160 7squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000164 2squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000180 1squamous cell GEO : GSM532916 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).