Deep sequencing reads for mature sequence MIMAT0011450

Stem-loop ID cel-mir-1832b
Mature ID cel-miR-1832b-3p
Reads 
cel-miR-1832b-5p                            cel-miR-1832b-3p           Count     RPM (mean number of reads per million)
............................................AGUGGGCAGAGCGAUUCGCUGAU  1         9.45
CAGCGAAUCGCUCGGCCCACUUUUGUGAACCAAUCAGCGUCAAAAGUGGGCAGAGCGAUUCGCUGAU
(((((((((((((.((((((((((((((.....)))....))))))))))).))))))))))))).. (-44.10)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000205 1adult GEO : GSM604034 strain: daf-2(e1379) mutant, age: Day 0 [ de Lencastre A et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).