Deep sequencing reads for mature sequence MIMAT0011659

Stem-loop ID ppc-mir-71
Mature ID ppc-miR-71
Reads
                                ppc-miR-71                                                                        Count     RPM (mean number of reads per million)
...........................UGAAAGACCUGUUGGUAGUGAGACG.............................................................  2         218
...........................UGAAAGACCUGUUGGUAGUGAGAC..............................................................  1         109
GUCGUGUCGACGACCGACGAGCGAAGGUGAAAGACCUGUUGGUAGUGAGACGAUGAAAUUUAAUCCUUUCGUAUCACUACCCAGGCUUUCGCCCUUGCUUCGGUACAAUGGCC
(((((.......(((((..(((((.((((((((.((((..((((((((.((((...............)))).)))))))))))))))))))).))))))))))...))))). (-50.36)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000027 7whole body GEO : GSM378787 [ de Wit E et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).