Deep sequencing reads for mature sequence MIMAT0011741

Stem-loop ID osa-MIR2118b
Mature ID osa-miR2118b
Reads
                                                                                                                         osa-miR2118b                                                Count     RPM (mean number of reads per million)
AUGAGCGAGGAAGAGGAAGAAAGAGGUAGUCUAAGAGCAGUGGGAAUGGGAACAUAGAGGAAAAAUGAGCUCUCAGUGUUCACUUCUGGAAGUGGAGGUGGAUAUUUGUCUCAGUAUUUUUCCCGAUGCCUCCCAUUCCUAUCGUUCUUAGGUGCUCCUUCCUCUUCCUUUCAGCUCAU
(((((((((((((((((((...(((.((.(((((((((.((((((((((((.(((.(.(((((((((......((((((((((((((......))))))))))).)))......)))))))))).)))..)))))))))))).)))))))))))))))))))))))))))...)))))) (-87.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000009 3whole body GEO : GSM407072 [ Johnson C et al.]
ER0000000202 21whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).
2