Deep sequencing reads for mature sequence MIMAT0015000

Stem-loop ID hsa-mir-3134
Mature ID hsa-miR-3134
Reads 
                                              hsa-miR-3134                 Count     RPM (mean number of reads per million)
............................................UGAUGGAUAAAAGACUACAUAUU.......  10        1.2
............................................UGAUGGAUAAAAGACUACAUA.........  2         0.444
UGUAUCCAAUGUGUAGUCUUUUAUCCCUCACAUGGAGUAAAAUAUGAUGGAUAAAAGACUACAUAUUGGGUACA
.(((((((((((((((((((((((((.(((.((........)).))).))))))))))))))))))))))))). (-41.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000103 2melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000106 2melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 2melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000110 2melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 4melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000147 1 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000165 1 GEO : GSM532901 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).