Deep sequencing reads for mature sequence MIMAT0016872

Stem-loop ID hsa-mir-4317
Mature ID hsa-miR-4317
Reads 
         hsa-miR-4317                                             Count     RPM (mean number of reads per million)
AAAAGGCGAGACAUUGCCAGGGAGUUUAUUUUGUAGCUCUCUUGAUAAAAUGUUUUAGCAAACAC
.....((((((((((.(.((((((((........)))))))).)....)))))))).))...... (-17.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000107 2melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000185 1 GEO : GSM532921 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).