Deep sequencing reads for mature sequence MIMAT0018359

Stem-loop ID hsa-mir-3943
Mature ID hsa-miR-3943
Reads 
                        hsa-miR-3943                                                                 Count     RPM (mean number of reads per million)
......................UAGCCCCCAGGCUUCACUUGGCGU......................................................  2         7.05
......................UAGCCCCCAGGCUUCACUUGGCG.......................................................  1         2.63
CACACAGACGGCAGCUGCGGCCUAGCCCCCAGGCUUCACUUGGCGUGGACAACUUGCUAAGUAAAGUGGGGGGUGGGCCACGGCUGGCUCCUACCUGGAC
.........(.((((((.((((((.(((((..((((.((((((((.(.....).)))))))).))))))))).)))))).)))))).)(((.....))). (-52.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 2embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 1embryonic stem cell GEO : GSM541797 [ Bar M et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).