Deep sequencing reads for mature sequence MIMAT0019764

Stem-loop ID hsa-mir-4680
Mature ID hsa-miR-4680-5p
Reads 
   hsa-miR-4680-5p                     hsa-miR-4680-3p              Count     RPM (mean number of reads per million)
.........agaacucuUgcagucUuagAUgu..................................  5         4
UAUAAGAACUCUUGCAGUCUUAGAUGUUAUAAAAAUAUAUAUCUGAAUUGUAAGAGUUGUUAGCAC
..(((.((((((((((((.((((((((.(((....))))))))))))))))))))))).))).... (-23.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000109 5melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).