Deep sequencing reads for mature sequence MIMAT0020925

Stem-loop ID hsa-mir-550a-3
Mature ID hsa-miR-550a-3-5p
Reads
                hsa-miR-550a-3-5p                         hsa-miR-550a-3p                         Count     RPM (mean number of reads per million)
...........................................................UGUCUUACUCCCUCAGGCACAU..............  110       9.62
...........................................................UGUCUUACUCCCUCAGGCACA...............  4         0.19
.............................................................UCUUACUCCCUCAGGCACAUCU............  3         3.77
GAUGCUUUGCUGGCUGGUGCAGUGCCUGAGGGAGUAAGAGUCCUGUUGUUGUAAGAUAGUGUCUUACUCCCUCAGGCACAUCUCCAACAAGUCUC
((.((((.(.(((..(((...((((((((((((((((((...(((((.......)))))..))))))))))))))))))))).))).))))).)) (-43.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 2embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 2embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 11melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000105 2 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 4melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 4melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 22melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 5melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 14melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 19melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 23melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 8melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 5melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000150 1squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000165 1 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000264 1 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4