Deep sequencing reads for mature sequence MIMAT0021124

Stem-loop ID hsa-mir-5193
Mature ID hsa-miR-5193
Reads 
                                                             hsa-miR-5193                                      Count     RPM (mean number of reads per million)
CCUAGGAAAGGCUGCUGGUAACUGGGAUGGGGGUUGGGGGGAGGUAAGAAGUCUCUGACUCCUCCUCUACCUCAUCCCAGUUCCAUCACCUGAAGUGGACCUCUUGGGA
(((((((..(((..(.((.(((((((((((((...((((((((...(((....)))..))))))))...))))))))))))))).((....)).)..).))))))))). (-55.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000140 2squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000164 1squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000171 1 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).