Mature sequence cel-miR-2-3p

• Accession number: MIMAT0000004
• ID: cel-miR-2-3p
• Previous IDs: cel-miR-2
• Stem-Loop: cel-mir-2
• Sequence: uaucacagccagcuuugaugugc
• Deep sequencing: 48497 reads, 19 experiments
• Database links:
  • RNAcentral:URS000051D980_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-2
  • microrna.org:cel-miR-2-3p

References

1. PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2. PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4. PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5. PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
6. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
7. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
8. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
9. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).