Mature mmu-miR-99a-5p
| Accession | MIMAT0000131 |
| Description | mmu-miR-99a-5p mature miRNA |
| Hairpins | |
| Sequence | AACCCGUAGAUCCGAUCUUGUG |
| Evidence |
experimental
cloned [1-3], Illumina [4-5] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0043031 negative regulation of macrophage activation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | occurs_in CL:0002476 |
| acts_upstream_of | GO:0045649 regulation of macrophage differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | occurs_in CL:0002476 |
| acts_upstream_of | GO:0045824 negative regulation of innate immune response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | occurs_in CL:0002479 |
| acts_upstream_of | GO:0046628 positive regulation of insulin receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | |
| acts_upstream_of | GO:0050728 negative regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | occurs_in CL:0002479 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | has_input UniProtKB:P06804 |
| involved_in | GO:0010936 negative regulation of macrophage cytokine production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | occurs_in CL:0002476 |
| involved_in | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | occurs_in CL:0002476 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | has_input UniProtKB:P06804 |
| involved_in | GO:0071222 cellular response to lipopolysaccharide |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | occurs_in CL:0002476 |
| involved_in | GO:0071346 cellular response to type II interferon |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29849090 | occurs_in CL:0002476 |
