Mature mmu-miR-126a-5p
| Accession | MIMAT0000137 |
| Description | mmu-miR-126a-5p mature miRNA |
| Hairpins | |
| Sequence | CAUUAUUACUUUUGGUACGCG |
| Evidence |
experimental
cloned [1-2,4], Illumina [5-6] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24584117 | has_input UniProtKB:Q925U3 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24584117 | has_input UniProtKB:Q925U3 |
| involved_in | GO:0045747 positive regulation of Notch signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24584117 | occurs_in CL:0000071 |
| involved_in | GO:0071499 cellular response to laminar fluid shear stress |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24584117 | occurs_in CL:0000071 |
| involved_in | GO:1905564 positive regulation of vascular endothelial cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24584117 |
