Accession | MIMAT0000142 |
Description | mmu-miR-9-5p mature miRNA |
Hairpins | |
Sequence | UCUUUGGUUAUCUAGCUGUAUGA |
Evidence |
experimental
cloned [1-2,4], Illumina [5-6] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0008035 high-density lipoprotein particle binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30367726 | occurs_in UBERON:0000955 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | has_input UniProtKB:Q9WV60 |
involved_in | GO:0007162 negative regulation of cell adhesion |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | occurs_in CL:2000058 |
involved_in | GO:0033689 negative regulation of osteoblast proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | has_input UniProtKB:Q9WV60 |
involved_in | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | |
located_in | GO:0070062 extracellular exosome |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30367726 | produced_by CL:0000540 |