Accession | MIMAT0000246 |
Description | mmu-miR-122-5p mature miRNA |
Hairpins | |
Sequence | UGGAGUGUGACAAUGGUGUUUG |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q8BPQ2 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P05064 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q06831 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:G5E8G5 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P09242 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q9CZU6 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:E9Q414 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:G3X925 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:O08601 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P08226 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P10648 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P13516 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P19096 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P35582 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P35583 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P52825 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:P97742 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q4LDG0 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q5SWU9 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q60644 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q91V92 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q99MZ3 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q9EP96 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22820290 | has_input UniProtKB:Q9QXZ6 |
involved_in | GO:0010666 positive regulation of cardiac muscle cell apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22453009 |