Accession | MIMAT0000254 |
Description | hsa-miR-10b-5p mature miRNA |
Hairpins | |
Sequence | UACCCUGUAGAACCGAAUUUGUG |
Evidence |
experimental
cloned [2-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010884 positive regulation of lipid storage |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19780876 | occurs_in CL:0000182 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19780876 | has_input UniProtKB:Q07869 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19780876 | has_input UniProtKB:Q07869 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22955733 | has_input UniProtKB:P17948 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29331391 | has_input UniProtKB:Q07955 |
involved_in | GO:0030949 positive regulation of vascular endothelial growth factor receptor signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22955733 | occurs_in CL:0002618 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22955733 | has_input UniProtKB:P17948 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24804980 | has_input UniProtKB:P23560 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24804980 | has_input UniProtKB:P23560 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24804980 | has_input UniProtKB:P23560 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29331391 | has_input UniProtKB:Q07955 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19780876 | has_input UniProtKB:Q07869 |
involved_in | GO:0090050 positive regulation of cell migration involved in sprouting angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22955733 | occurs_in CL:0002618 |
involved_in | GO:1903589 positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22955733 | occurs_in CL:0002618 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
located_in | GO:0070062 extracellular exosome |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31926946 | produced_by CL:0000235 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|