Mature sequence dme-bantam-3p

Accession numberMIMAT0000365
IDdme-bantam-3p
Previous IDsdme-bantam
Stem-Loop dme-bantam
Sequence
ugagaucauuuugaaagcugauu
Get sequence
Deep sequencing10705728 reads, 49 experiments
Database links
Predicted targets
QuickGO function

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:12946623 "Big things from a little RNA" Moberg KH, Hariharan IK Trends Cell Biol. 13:455-457(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).