Accession | MIMAT0000400 |
Description | dme-miR-31a-5p mature miRNA |
Hairpins | |
Sequence | UGGCAAGAUGUCGGCAUAGCUGA |
Evidence |
experimental
cloned [1], 454 [2-3], Illumina [3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33007980 | |
involved_in | GO:0035220 wing disc development |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:33007980 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33007980 |