Accession | MIMAT0000456 |
Description | hsa-miR-186-5p mature miRNA |
Hairpins | |
Sequence | CAAAGAAUUCUCCUUUUGGGCU |
Evidence |
experimental
cloned [1-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0032410 negative regulation of transporter activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26626440 | has_input UniProtKB:P08183 |
acts_upstream_of | GO:1902255 positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27714074 | |
acts_upstream_of | GO:1902430 negative regulation of amyloid-beta formation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25100943 | has_output UniProtKB:P05067-PRO_0000000093 |
acts_upstream_of | GO:1905700 negative regulation of xenobiotic detoxification by transmembrane export across the plasma membrane |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26626440 | |
acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26626440 | has_input UniProtKB:P09211 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25100943 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26626440 | has_input UniProtKB:P08183 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27714074 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25100943 | has_input UniProtKB:Q92542 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26626440 | has_input UniProtKB:P08183 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27714074 | has_input UniProtKB:P10636 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25100943 | has_input UniProtKB:Q92542 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26626440 | has_input UniProtKB:P08183 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27714074 | has_input UniProtKB:P10636 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|