Mature sequence cbr-let-7

Accession numberMIMAT0000463
IDcbr-let-7
Stem-Loop cbr-let-7
Sequence
ugagguaguagguuguauaguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).