Mature sequence cbr-miR-80

Accession numberMIMAT0000487
IDcbr-miR-80
Stem-Loop cbr-mir-80
Sequence
ugagaucauuaguugaaagccga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).