Mature sequence cbr-miR-233

Accession numberMIMAT0000498
IDcbr-miR-233
Stem-Loop cbr-mir-233
Sequence
uugagcaaugcgcaugugcggga
Get sequence
Deep sequencing reads, experiments

References