Accession | MIMAT0000514 |
Description | mmu-miR-30c-5p mature miRNA |
Hairpins | |
Sequence | UGUAAACAUCCUACACUCUCAGC |
Evidence |
experimental
cloned [1-4], Illumina [5-6] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010868 negative regulation of triglyceride biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | occurs_in UBERON:0002107 |
acts_upstream_of | GO:0045541 negative regulation of cholesterol biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | occurs_in UBERON:0002107 |
acts_upstream_of | GO:0045717 negative regulation of fatty acid biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | occurs_in UBERON:0002107 |
acts_upstream_of | GO:0110114 negative regulation of lipid transporter activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | occurs_in CL:0000182 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | has_input UniProtKB:E9Q414 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | has_input UniProtKB:O08601 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | has_input UniProtKB:Q8BHI7 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | has_input UniProtKB:Q91YX5 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | has_input UniProtKB:Q9QYS9 |
involved_in | GO:0042632 cholesterol homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27365390 | occurs_in UBERON:0001969 |