Mature mmu-miR-103-3p
| Accession | MIMAT0000546 |
| Description | mmu-miR-103-3p mature miRNA |
| Hairpins | |
| Sequence | AGCAGCAUUGUACAGGGCUAUGA |
| Evidence |
experimental
cloned [2-4], Illumina [5,7] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21654750 | has_input UniProtKB:P49817 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24000013 | has_input UniProtKB:P49817 |
| involved_in | GO:0001678 intracellular glucose homeostasis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | occurs_in UBERON:0002107 |
| involved_in | GO:0032869 cellular response to insulin stimulus |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | occurs_in UBERON:0002107 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21654750 | has_input UniProtKB:P49817 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24000013 | occurs_in CL:0000136 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | has_input UniProtKB:P49817 |
| involved_in | GO:0045599 negative regulation of fat cell differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21654750 | occurs_in UBERON:0035818 |
| involved_in | GO:0045599 negative regulation of fat cell differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | |
| involved_in | GO:0045722 positive regulation of gluconeogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21654750 | occurs_in UBERON:0002107 |
| involved_in | GO:0046325 negative regulation of glucose import |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | occurs_in CL:0000136 |
| involved_in | GO:0046627 negative regulation of insulin receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21654750 | occurs_in UBERON:0001013 |
| involved_in | GO:0046627 negative regulation of insulin receptor signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24000013 | occurs_in CL:0000136 |
