Mature mmu-miR-326-3p
| Accession | MIMAT0000559 |
| Description | mmu-miR-326-3p mature miRNA |
| Hairpins | |
| Sequence | CCUCUGGGCCCUUCCUCCAGU |
| Evidence |
experimental
cloned [1], Illumina [2-3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:1901202 negative regulation of extracellular matrix assembly |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24279830 | occurs_in UBERON:0002048 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24279830 | has_input UniProtKB:P04202 |
| involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24279830 | has_input UniProtKB:P04202 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24279830 | has_input UniProtKB:P04202 |
