Mature mmu-miR-328-3p
| Accession | MIMAT0000565 |
| Description | mmu-miR-328-3p mature miRNA |
| Hairpins | |
| Sequence | CUGGCCCUCUCUGCCCUUCCGU |
| Evidence |
experimental
cloned [2-3], Illumina [4-5] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:0002027 regulation of heart rate |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21098446 | |
| involved_in | GO:1904878 negative regulation of calcium ion transmembrane transport via high voltage-gated calcium channel |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21098446 | occurs_in CL:0000746 |
| involved_in | GO:1905001 negative regulation of membrane repolarization during atrial cardiac muscle cell action potential |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21098446 |
