Mature sequence rno-miR-349

Accession numberMIMAT0000599
IDrno-miR-349
Stem-Loop rno-mir-349
Sequence
cagcccugcugucuuaaccucu
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).